    
<?xml version="1.0" encoding="UTF-8"?>
<rss version="2.0"
	xmlns:content="http://purl.org/rss/1.0/modules/content/"
	xmlns:wfw="http://wellformedweb.org/CommentAPI/"
	xmlns:dc="http://purl.org/dc/elements/1.1/"
	xmlns:atom="http://www.w3.org/2005/Atom"
	xmlns:sy="http://purl.org/rss/1.0/modules/syndication/"
	xmlns:slash="http://purl.org/rss/1.0/modules/slash/"
	>

<channel>
	<title>Penn Museum Blog</title>
	<atom:link href="http://penn.museum/blog/feed/" rel="self" type="application/rss+xml" />
	<link>http://penn.museum/blog</link>
	<description>Beyond the Gallery Walls</description>
	<lastBuildDate>Tue, 15 May 2012 18:03:33 +0000</lastBuildDate>
	<language>en</language>
	<sy:updatePeriod>hourly</sy:updatePeriod>
	<sy:updateFrequency>1</sy:updateFrequency>
	
		<item>
		<title>Kenya 2012: Mpala Research Centre and Wildlife Foundation</title>
		<link>http://penn.museum/blog/museum/kenya-2012-mpala-research-centre-and-wildlife-foundation/</link>
		<comments>http://penn.museum/blog/museum/kenya-2012-mpala-research-centre-and-wildlife-foundation/#comments</comments>
		<pubDate>Tue, 15 May 2012 17:52:29 +0000</pubDate>
		<dc:creator>Erika Hoffman</dc:creator>
				<category><![CDATA[Kenya 2012]]></category>
		<category><![CDATA[Museum]]></category>

		<guid isPermaLink="false">http://penn.museum/blog/?p=4527</guid>
		<description><![CDATA[For someone who has never participated in an on-site research trip for archaeology/anthropology in a foreign place, the Mpala Research Centre and Wildlife Foundation facilities were not what I was expecting.  Not only are the accommodations comparable, if not fancier, than the apartment where I was living last semester, but the common dining area and [...]]]></description>
			<content:encoded><![CDATA[<p>For someone who has never participated in an on-site research trip for archaeology/anthropology in a foreign place, the Mpala Research Centre and Wildlife Foundation facilities were not what I was expecting.  Not only are the accommodations comparable, if not fancier, than the apartment where I was living last semester, but the common dining area and timed meal times create a real community feel for all those participating in research through the center.  Despite encounters with certain interesting and some unwanted creatures, adjusting to living here has gone smoother than I once anticipated.</p>
<p>Besides the main dining area which reminds me of a “mess hall” at camp, there is also a research laboratory and library that are available for use by all researchers and visitors.  The compound is spread over a large area, but it is simple to navigate during the day and there are guard escorts to aid wanderers once darkness inhibits all sense of direction.  I managed to collect some photos from some of the housing buildings, as well as the surrounding areas.  These are a few examples of the living arrangements, both shared and individual, as well as some shots of the local animal life.</p>

<a href='http://penn.museum/blog/museum/kenya-2012-mpala-research-centre-and-wildlife-foundation/attachment/screen-shot-2012-05-15-at-4-16-16-pm/' title='Shot of a few of the main buildings at the Mpala compound'><img width="150" height="150" src="http://penn.museum/blog/wp-content/uploads/2012/05/Screen-shot-2012-05-15-at-4.16.16-PM-150x150.png" class="attachment-thumbnail" alt="Shot of a few of the main buildings at the Mpala compound" title="Shot of a few of the main buildings at the Mpala compound" /></a>
<a href='http://penn.museum/blog/museum/kenya-2012-mpala-research-centre-and-wildlife-foundation/attachment/screen-shot-2012-05-15-at-4-19-29-pm/' title='The outside of Kathleen&#039;s accommodations- solar roof!'><img width="150" height="150" src="http://penn.museum/blog/wp-content/uploads/2012/05/Screen-shot-2012-05-15-at-4.19.29-PM-150x150.png" class="attachment-thumbnail" alt="The outside of Kathleen&#039;s accommodations- solar roof!" title="The outside of Kathleen&#039;s accommodations- solar roof!" /></a>
<a href='http://penn.museum/blog/museum/kenya-2012-mpala-research-centre-and-wildlife-foundation/attachment/screen-shot-2012-05-15-at-4-22-39-pm/' title='The posh inside of Kathleen&#039;s abode'><img width="150" height="150" src="http://penn.museum/blog/wp-content/uploads/2012/05/Screen-shot-2012-05-15-at-4.22.39-PM-150x150.png" class="attachment-thumbnail" alt="The posh inside of Kathleen&#039;s abode" title="The posh inside of Kathleen&#039;s abode" /></a>
<a href='http://penn.museum/blog/museum/kenya-2012-mpala-research-centre-and-wildlife-foundation/attachment/screen-shot-2012-05-15-at-4-24-48-pm/' title='Example of the solar lamps inside'><img width="150" height="150" src="http://penn.museum/blog/wp-content/uploads/2012/05/Screen-shot-2012-05-15-at-4.24.48-PM-150x150.png" class="attachment-thumbnail" alt="Example of the solar lamps inside" title="Example of the solar lamps inside" /></a>
<a href='http://penn.museum/blog/museum/kenya-2012-mpala-research-centre-and-wildlife-foundation/attachment/screen-shot-2012-05-15-at-4-26-44-pm/' title='The outdoor porch of the house where Louise and I are staying'><img width="150" height="150" src="http://penn.museum/blog/wp-content/uploads/2012/05/Screen-shot-2012-05-15-at-4.26.44-PM-150x150.png" class="attachment-thumbnail" alt="The outdoor porch of the house where Louise and I are staying" title="The outdoor porch of the house where Louise and I are staying" /></a>
<a href='http://penn.museum/blog/museum/kenya-2012-mpala-research-centre-and-wildlife-foundation/attachment/screen-shot-2012-05-15-at-4-29-49-pm/' title='Living room shot'><img width="150" height="150" src="http://penn.museum/blog/wp-content/uploads/2012/05/Screen-shot-2012-05-15-at-4.29.49-PM-150x150.png" class="attachment-thumbnail" alt="Living room shot" title="Living room shot" /></a>
<a href='http://penn.museum/blog/museum/kenya-2012-mpala-research-centre-and-wildlife-foundation/attachment/screen-shot-2012-05-15-at-4-31-55-pm/' title='A dik-dik that frequents our backyard'><img width="150" height="150" src="http://penn.museum/blog/wp-content/uploads/2012/05/Screen-shot-2012-05-15-at-4.31.55-PM-150x150.png" class="attachment-thumbnail" alt="A dik-dik that frequents our backyard" title="A dik-dik that frequents our backyard" /></a>
<a href='http://penn.museum/blog/museum/kenya-2012-mpala-research-centre-and-wildlife-foundation/attachment/screen-shot-2012-05-15-at-4-33-21-pm/' title='Another visitor'><img width="150" height="150" src="http://penn.museum/blog/wp-content/uploads/2012/05/Screen-shot-2012-05-15-at-4.33.21-PM-150x150.png" class="attachment-thumbnail" alt="Another visitor" title="Another visitor" /></a>
<a href='http://penn.museum/blog/museum/kenya-2012-mpala-research-centre-and-wildlife-foundation/attachment/screen-shot-2012-05-15-at-4-34-31-pm/' title='The Graham Library available to researchers'><img width="150" height="150" src="http://penn.museum/blog/wp-content/uploads/2012/05/Screen-shot-2012-05-15-at-4.34.31-PM-150x150.png" class="attachment-thumbnail" alt="The Graham Library available to researchers" title="The Graham Library available to researchers" /></a>
<a href='http://penn.museum/blog/museum/kenya-2012-mpala-research-centre-and-wildlife-foundation/attachment/screen-shot-2012-05-15-at-4-36-28-pm/' title='McCormack Laboratory'><img width="150" height="150" src="http://penn.museum/blog/wp-content/uploads/2012/05/Screen-shot-2012-05-15-at-4.36.28-PM-150x150.png" class="attachment-thumbnail" alt="McCormack Laboratory" title="McCormack Laboratory" /></a>
<a href='http://penn.museum/blog/museum/kenya-2012-mpala-research-centre-and-wildlife-foundation/attachment/screen-shot-2012-05-15-at-4-37-46-pm/' title='The back of the lab facilities'><img width="150" height="150" src="http://penn.museum/blog/wp-content/uploads/2012/05/Screen-shot-2012-05-15-at-4.37.46-PM-150x150.png" class="attachment-thumbnail" alt="The back of the lab facilities" title="The back of the lab facilities" /></a>
<a href='http://penn.museum/blog/museum/kenya-2012-mpala-research-centre-and-wildlife-foundation/attachment/screen-shot-2012-05-15-at-4-38-37-pm-3/' title='Just one of the beautiful views'><img width="150" height="150" src="http://penn.museum/blog/wp-content/uploads/2012/05/Screen-shot-2012-05-15-at-4.38.37-PM2-150x150.png" class="attachment-thumbnail" alt="Just one of the beautiful views" title="Just one of the beautiful views" /></a>

<p>On Mpala’s website (<a href="http://www.mpala.org/index.php">http://www.mpala.org/index.php)</a>, it is described as a “living laboratory” and after being here now for a few days, I can only agree.  Everywhere you turn there is the opportunity to observe animal and plant species and to converse with many students studying subjects in ecology, anthropology, etc.  The Mpala Research Centre property is beautifully maintained, but the best part about the location is that you are surrounded by the natural African savanna habitat.  It is the only place in my life thus far that I have been able to wake up and see the sun rise over untouched land.  Look to my left, and if it’s early enough in the morning, I can see the peaks of Mount Kenya (later on they are usually obscured by clouds).</p>
<p>As a team, we’re not just here to observe the beautiful African views.  We have travelled to a few sites and it’s amazing that by only driving for a half hour through the precarious landscape, we come across burials and past sites of human occupancy (as Paul mentioned, we’re still not sure of the dating for any of the remains, but the plan is to find out!).  Today we headed back out to the first burial site in the hopes of starting the excavation process and were successful in discovering human remains (more than when the first time the site was examined).  We will delegate another blog entry to describe those processes and discoveries after more analysis has taken place.  It’s only a bonus that we get to see wildlife such as giraffes, Grevy’s zebras, elephants, dik-diks, etc. as we trek through the wilderness for the sake of archeological research!</p>
]]></content:encoded>
			<wfw:commentRss>http://penn.museum/blog/museum/kenya-2012-mpala-research-centre-and-wildlife-foundation/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>Kenya 2012: A Petit Primer on the Genetics of Lactase Persistence &#8211; The Suckling Saga 2/2</title>
		<link>http://penn.museum/blog/africa-2/kenya/kenya-2012-a-petit-primer-on-the-genetics-of-lactase-persistence-the-suckling-saga-22/</link>
		<comments>http://penn.museum/blog/africa-2/kenya/kenya-2012-a-petit-primer-on-the-genetics-of-lactase-persistence-the-suckling-saga-22/#comments</comments>
		<pubDate>Tue, 15 May 2012 16:07:49 +0000</pubDate>
		<dc:creator>Paul Mitchell</dc:creator>
				<category><![CDATA[Africa]]></category>
		<category><![CDATA[Kenya]]></category>
		<category><![CDATA[Kenya 2012]]></category>
		<category><![CDATA[Museum]]></category>
		<category><![CDATA[Physical Anthropology]]></category>
		<category><![CDATA[Research]]></category>

		<guid isPermaLink="false">http://penn.museum/blog/?p=4555</guid>
		<description><![CDATA[(Continued from the first part of this post: “Lactation, Lips, and Other Mammalian Curiosities”) Now, consider the facts in the first part of this post about the mammalian milk bar and take a look at these orphan elephants at the David Sheldrick Wildlife Trust in Nairobi. I visited these trunky critters with Kathleen and Louise [...]]]></description>
			<content:encoded><![CDATA[<p>(Continued from the first part of this post: “Lactation, Lips, and Other Mammalian Curiosities”)</p>
<p>Now, consider the facts in the first part of this post about the mammalian milk bar and take a look at these orphan elephants at the David Sheldrick Wildlife Trust in Nairobi. I visited these trunky critters with Kathleen and Louise on Saturday, before we left for Laikipia early on Sunday. These young pachyderms find themselves without a mom to care for them due to poaching, illness, or other natural causes. The fine folks at the elephant orphanage take in these little duders from all over Kenya, from Turkana to Tsavo, and care for them until just about weaning time, when they are reintegrated into the wild elephant populations around the country. Without these folks, these little elephants wouldn’t stand a chance. It took Dr. Dame Daphne Sheldrick, animal behaviorist extraordinaire and wife of the man for whom the trust is named, twenty years to perfect the synthetic formula. Cow milk just doesn’t do it for elephants. Each mammalian species produces milk especially formulated for the needs of its young.  The rapid growth required by young blue whales, for example, is such that the fat and hormone content of the mother blue whale’s milk would make your indulgent gelato look like diet fare and cause a Major League baseball player to blush, respectively. Similarly, these elephants require a whole mess of nutrients that only elephant milk or a specially concocted substitute may provide. Since the folks at the Wharton School of Business have decided that the start-up elephant dairy I’ve proposed is not feasible in the current economic climate, the later option will have to do. These elephants seem to like it.</p>
<p><a href='http://youtu.be/t9QkvTX_OCY'>David Sheldrick Wildlife Trust Elephants 1/2</a></p>
<p>Of course, lactation is not forever. Eventually, these kiddos, like all mammals, move on to sweeter meats, so to say. For all mammals except humans, weaning signals the end of lifetime milk consumption. This shift is not only behavioral, but also implicates an enzyme in the stomach known as lactase. Lactase has the job of breaking down the milk sugar lactose. Evolution, being a thrifty process, has produced critters that stop creating lactase after weaning, as no more lactose is ingested after weaning and thus there is no need for the body to expend energy and resources making an unnecessary enzyme. Only in human populations that have practiced dairying for thousands of years is the above condition changed. In these select groups of bipedal primates, lactase is produced throughout life.</p>
<p><a href='http://youtu.be/NkveylSouJs'>David Sheldrick Wildlife Trust Elephants 2/2</a></p>
<p>As anyone with lactose intolerance can tell you, it isn’t fatal to ingest lactose if you don’t have lactase. It just makes for an interesting gastrointestinal experience. If you’re in a place where food is scarce or even a few extra nutrients matter, the ingestion of milk from dairy animals will give you a hefty evolutionary advantage. So people did it. All the better, and all the more evolutionarily advantageous, if you happen to produce even just a little lactase as an adult. If you produce lactase and break down some of the lactose, you have access to nutrients unavailable to the lactose intolerant. As almost all traits vary in populations, the ability to produce lactase is not binary, either on or off. Instead, it’s continuous, and some people did produce a small amount naturally by luck of the genetic draw. As some elementary Darwinian logic shows, this trait of increasing and persistent lactase production in adulthood, after weaning, will become more prevalent in populations which have access to milk throughout life. The cultural practice of dairying coevolves with the persistence of lactase production after weaning. Interestingly enough, this idea isn’t just some wackadoo academic theory. It happened, and it happened multiple times in separate places. If you’re of northern European stock like myself, you probably ingest lactase like nobody’s business, as we’ve been squeezing udders for millennia. Not so for East Asians, who have not traditionally practiced dairying and thus have a low prevalence of the gene for lactase persistence, as it’s called, in their population. Another place where lactase persistence occurs separately is East Africa, although much later than northern Europe.</p>
<p>The exact details of when this happened is a little sketchy for East Africa, but we do know that the trait of lactase persistence evolved separately here from other places like northern Europe because the genetic basis of the change is different in East Africans and other lactose tolerant populations. Although the same gene is affected, there are different SNPs (single nucleotide polymorphisms) that switch lactase production on. To explain a bit more extensively for those who have been napping in biology class, genes are just a long string of nucleotides, little nubbins on your chromosomes, commonly abbreviated A, C, T, and G. To make things simple, let’s say that genes contain instructions for making proteins, such as the enzyme lactase. Of course, the story is more complex than the way I’m presenting it here, but for our present purposes, it’s a useful fiction.</p>
<p>Let’s say that the gene for making lactase is twenty nucleotides long. Here’s our hypothetical lactase gene:<br />
ATCGATCGATCGATCGATCG</p>
<p>Got it?<br />
Ok. Now, let’s say that the above code is for people who stop producing lactase after weaning. This code is the plesiomorphic, or ancestral, state for all mammals. In northern Europeans, the following change happened:<br />
CTCGATCGATCGATCGATCG</p>
<p>Notice how the first position is now a C rather than an A.<br />
Okay?<br />
Okay. This change causes the gene to continue lactase production after weaning. As we discussed above, this change spread throughout the population because it was very evolutionarily advantageous, which just means that it helped you have more kids because you could get more nutrients, have strong bones and teeth, or were just really sexy in that milk mustache.</p>
<p>Now, here’s the thing. In East Africans, our hypothetical gene looks like this:<br />
ATCGATCGATCGATCGATCA</p>
<p>Notice how the last position is now an A rather than a G. Notice how the first position is like the ancestral position and not like the northern European condition wherein the first nucleotide A is switched to C. Since you inherit these genetic changes, this situation indicates that Africans and Europeans developed their differences in this gene after the two groups were geographically separated. Of course, there’s admixture between groups (which is the geneticist’s way of saying that people from all sorts of different groups have&#8230; fun&#8230; with each other), but the epicenter of each respective change is geographically separate, so that the frequency of the African form of the gene is at a very high percentage of the population only in Africa and the European form is at a very high percentage of the population only in Europe. Copasetic? Cool.</p>
<p>Also, and this is blow-your-socks-off-awesome, we know that these two <em>separate genetic differences</em> at the nucleotide level produce the <em>same functional difference </em>as the change in northern Europeans: East Africans are lactose tolerant, just like northern Europeans, but the genetic changes are different. And we know it happened for the same cultural reasons.</p>
<p>Here’s the shorter version:<br />
East Africans evolved the ability to digest milk after weaning separately from other human populations that can also digest milk after weaning.</p>
<p>(The short version isn’t as fun, in my opinion.)</p>
<p>Here’s the question I’m interested in answering with this project:<br />
When did this happen?</p>
<p>Genes aren’t so hot at giving exact dates for when these sorts of changes occur, although they can give a rough estimate. If you’re really curious, ask me sometime about the details of dating genetic changes. I also happen to know a whole slew of jokes about genetics that are not kosher for public consumption and it’s really killing me not to be able to post them. Just ask. Anyway, what you need to know is that we can use archaeology to figure out when these things happened. Stratigraphic, cultural, faunal, and radiographic measurements of dates can help us figure out the nitty-gritty details of the date of this change in East Africans. Answering the questions of how this genetic change was related to things like local herding practices, diet and health, environmental conditions, and much, much more can only be answered when we have a solid date for lactase persistence in East Africans.</p>
<p>And just like that, all covert-like, I present to you the “why?” of this project. When did East Africans develop lactase persistence? Among other things, that question is one we’re attempting to help answer. Getting anywhere close to figuring this thing out will not only involve genetics, skeletal biology, archaeology, and ethnohistory, but a lot of hard work and clear thinking. We’re on it, folks.</p>
<p>*****<br />
Okay. I’ve worn myself out with all the science. I’ve got more to blog about, but I’ll do some tomorrow. I did some digging today. I found some things. I’ll update later.<br />
*****</p>
<p>By the by, weren’t those elephants cute?</p>
]]></content:encoded>
			<wfw:commentRss>http://penn.museum/blog/africa-2/kenya/kenya-2012-a-petit-primer-on-the-genetics-of-lactase-persistence-the-suckling-saga-22/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>Photos from the MAYA 2012 Opening Celebration</title>
		<link>http://penn.museum/blog/maya-2/photos-from-the-maya-2012-opening-celebration/</link>
		<comments>http://penn.museum/blog/maya-2/photos-from-the-maya-2012-opening-celebration/#comments</comments>
		<pubDate>Tue, 15 May 2012 14:47:08 +0000</pubDate>
		<dc:creator>admin</dc:creator>
				<category><![CDATA[Maya]]></category>

		<guid isPermaLink="false">http://penn.museum/blog/?p=4536</guid>
		<description><![CDATA[The opening weekend of the MAYA 2012 exhibition was a huge success. The Museum was filled with colorful sites, sounds, and the smells of great Maya-inspired food. Some macaws and a turtle even showed up. Here are just a few of the pics of the day:]]></description>
			<content:encoded><![CDATA[<p>The opening weekend of the <a title="MAYA 2012" href="http://penn.museum/2012" target="_blank">MAYA 2012 exhibition</a> was a huge success. The Museum was filled with colorful sites, sounds, and the smells of great Maya-inspired food. Some macaws and a turtle even showed up. Here are just a few of the pics of the day:</p>
<p><object width="500" height="375" classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" codebase="http://download.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=6,0,40,0"><param name="flashvars" value="offsite=true&amp;lang=en-us&amp;page_show_url=%2Fphotos%2Fpennmuseum%2Fsets%2F72157629740602174%2Fshow%2F&amp;page_show_back_url=%2Fphotos%2Fpennmuseum%2Fsets%2F72157629740602174%2F&amp;set_id=72157629740602174&amp;jump_to=" /><param name="allowFullScreen" value="true" /><param name="src" value="http://www.flickr.com/apps/slideshow/show.swf?v=109615" /><param name="allowfullscreen" value="true" /><embed width="500" height="375" type="application/x-shockwave-flash" src="http://www.flickr.com/apps/slideshow/show.swf?v=109615" flashvars="offsite=true&amp;lang=en-us&amp;page_show_url=%2Fphotos%2Fpennmuseum%2Fsets%2F72157629740602174%2Fshow%2F&amp;page_show_back_url=%2Fphotos%2Fpennmuseum%2Fsets%2F72157629740602174%2F&amp;set_id=72157629740602174&amp;jump_to=" allowFullScreen="true" allowfullscreen="true" /></object></p>
]]></content:encoded>
			<wfw:commentRss>http://penn.museum/blog/maya-2/photos-from-the-maya-2012-opening-celebration/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>Kenya 2012: Lactation, Lips, and Other Mammalian Curiosities – The Suckling Saga 1/2</title>
		<link>http://penn.museum/blog/africa-2/kenya/kenya-2012-lactation-lips-and-other-mammalian-curiosities-the-suckling-saga-12/</link>
		<comments>http://penn.museum/blog/africa-2/kenya/kenya-2012-lactation-lips-and-other-mammalian-curiosities-the-suckling-saga-12/#comments</comments>
		<pubDate>Tue, 15 May 2012 04:42:49 +0000</pubDate>
		<dc:creator>Paul Mitchell</dc:creator>
				<category><![CDATA[Africa]]></category>
		<category><![CDATA[Kenya]]></category>
		<category><![CDATA[Kenya 2012]]></category>
		<category><![CDATA[Museum]]></category>
		<category><![CDATA[Physical Anthropology]]></category>
		<category><![CDATA[Research]]></category>

		<guid isPermaLink="false">http://penn.museum/blog/?p=4512</guid>
		<description><![CDATA[Below you’ll find some of the thoughts that have bubbled up in my mind while I’ve been pleasantly bumbling about Kenya. All of these things connect to the project which we’re undertaking in some way, but I hope you’ll indulge by ramblings on natural history just a smidgen, even if they seem somewhat far afield [...]]]></description>
			<content:encoded><![CDATA[<div>
<p><a href="http://penn.museum/blog/africa-2/kenya/kenya-2012-lactation-lips-and-other-mammalian-curiosities-the-suckling-saga-12/attachment/ele_sm/" rel="attachment wp-att-4513"><img class="alignnone size-medium wp-image-4513" src="http://penn.museum/blog/wp-content/uploads/2012/05/ele_sm-300x225.jpg" alt="" width="300" height="225" /></a></p>
<p>Below you’ll find some of the thoughts that have bubbled up in my mind while I’ve been pleasantly bumbling about Kenya. All of these things connect to the project which we’re undertaking in some way, but I hope you’ll indulge by ramblings on natural history just a smidgen, even if they seem somewhat far afield from the task of excavating skeletons shortly at hand.</p>
<p>*****</p>
</div>
<p>I visited an elephant orphanage on Saturday, and this is what I think:</p>
<p>Mammals suck.</p>
<p>They really do.</p>
<p>If you take a gander at the whole spread of animal excellence, from ants to zebras, you’ll indeed find that evolution has especially equipped mammals, above all other critters great and small, to suck. All the other groups of animals, including insects, fish, reptiles, amphibians, and birds, simply do not suck like mammals.</p>
<p>Of course, I do have to be delicate in my distinctions. We can call some of the ingestive functions which other animals undertake sucking, but their sucking has rather different properties than the mammalian form of the activity. Suction is achieved by the mouth of the tarantula, which slurps up the insides of its prey after injecting the victim with a cocktail of liquefying toxins with its fang-like chelicerae. The mosquito, an all too common and all too dangerous winged parasitic beastie, is well known to use its needle of a mouth to extract the blood of its host in exchange for a ruddy bump on the drill site and, potentially, a parting gift of the falciparal malaria plasmodium or something similarly unpleasant. However, the reason that all mammals suck as a class has to do with that classic shibboleth of mammalhood: producing milk.</p>
<p>Unlike the above pseudosuckers such as the mosquito and tarantula, the mammalian oral cavity busies itself during the first stage of neonatal life with little else than sucking. After birth, mammals from whales to mongooses (mongeese?) and bats to people all instinctively migrate their mouthparts to their mother’s (or, in some cases, to simply the nearest working) mammary glands. In the most primitive, evolutionarily speaking, mammals, the monotremes like echidnas and platypuses, the visible bit of the mammary gland on the momma is little more than an overgrown sweat pore which oozes milk for its little wiggling progeny. Of course, both the nipple and the lips become anatomically more committed to this infant care scheme in more derived mammals, including marsupials such as kangaroos, koalas, and opposums (Yes, opposums are marsupials!), and the more familiar <em>Eutherian</em> (Greek: “good or true beast”), true mammal, characters of chimpanzees, cheetahs, bears, and the like. Along with a body covering of hair and three particular inner ear bones, producing milk is what defines a mammal.</p>
<p>Consider the sort of commitment that mammalian mothers make by dint of their hoary phylogenetic inheritance: you not only have to cook your kid inside you and then push it out of its uterine gestational asylum, but you also have to have the thing suck on the spill-proof lids to your mammary glands until weaning, which varies from just days in rodents to over five years in big mammals like elephants and the weird kid down the street.</p>
<p>Mammalian motherhood, for this reason, is a lot of work. You might think all those mommy crocodiles are smiling because they aren’t afflicted with such an involved childcare strategy. Now, I’ll admit that we shouldn’t so quickly accuse these crocomoms of being deadbeats. Rearing their young isn’t necessarily hands-off, as some species of croc go to the trouble of protecting their newly hatched kids in their mouths for months until they’re able to fend for themselves, but they certainly don’t have to deal with that whole sticky lactation issue.</p>
<p>Those crocodiles may smile, but they don’t do much else. It’s not lips that move them to beam their flesh-rending, pearly whites at the world, but rather the immobile configuration of their soft facial tissues and rather conspicuous lack of lips. Try to rip the skin off of a crocodilian’s head. I have. The skin is darn near super-glued to the bone. These guys don’t suck. Their lips are missing and their tongues are about as stiff as boards. Baby crocs don’t drink milk, and their morphology reflects it. Birds, too. Birdy parents may caringly upchuck a meal into the gaping, chirping maws of their chicks, but there is no milk to be had. Those beaks don’t suck. Whether you’re a perpetually smiling croc or a stolid owl, your facial morphology, from the musculature to the bone, is simply non-sucky unless you’re a mammal.</p>
<p>All sorts of things accompany the mammalian need to suck. Consider teething. There’s a reason the first set of teeth are called milk teeth, and there’s a good reason that their eruption is linked to weaning. Consider the mother-child bond formed through the child’s ingestion of the lactating mother’s milk. There’s much to recommend to such a maternal link when you’ve got a kid that needs a parent to show it the ropes of social and survival skills. As a class, it’s fair to say that mammals need to learn more than most any other group of animals to survive and pass on their genes. Many mammals need not only milk but also the instruction of their mothers in (anthropomorphism ahoy!) social etiquette, food capture or location skills, and the like. The maternal bond, a phenomenon detectable not only at the behavioral but also at the hormonal level, is a fantastic way to keep a kid attentive to a teacher that can show it the things it needs to know so that the germ line advances yet another generation.  (Happy belated Mother’s Day, Mom! I’m sorry I’m so bad at remembering this stuff!)</p>
<p>Of course, sucking has other things to recommend to it. The tongue and lips must contort in certain ways in order to suck, and this same labiolingual yoga is necessary for speech production in our own species. Furthermore, kissing is a fantastic epiphenomenon of sucking. Without labile lips with which to suckle, pecking in the amorous rather than the avian sense would be darn near impossible. Plant a juicy wet one on the partner of your choice and thank your mammalian mother for lactating! (Thanks, Mom!)</p>
<p><a href="http://penn.museum/blog/africa-2/kenya/kenya-2012-lactation-lips-and-other-mammalian-curiosities-the-suckling-saga-12/attachment/ele_milk_sm/" rel="attachment wp-att-4514"><img class="alignnone size-medium wp-image-4514" src="http://penn.museum/blog/wp-content/uploads/2012/05/ele_milk_sm-300x225.jpg" alt="" width="300" height="225" /></a></p>
<p>(This post will be continued in a second part: “A <em>Petit</em> Primer on the Genetics of Lactase Persistence”)</p>
]]></content:encoded>
			<wfw:commentRss>http://penn.museum/blog/africa-2/kenya/kenya-2012-lactation-lips-and-other-mammalian-curiosities-the-suckling-saga-12/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>Kenya 2012: Bones, Bodies, Misbehavior*</title>
		<link>http://penn.museum/blog/africa-2/kenya/kenya-2012-bones-bodies-misbehavior/</link>
		<comments>http://penn.museum/blog/africa-2/kenya/kenya-2012-bones-bodies-misbehavior/#comments</comments>
		<pubDate>Mon, 14 May 2012 05:18:03 +0000</pubDate>
		<dc:creator>Paul Mitchell</dc:creator>
				<category><![CDATA[Africa]]></category>
		<category><![CDATA[Kenya]]></category>
		<category><![CDATA[Kenya 2012]]></category>
		<category><![CDATA[Physical Anthropology]]></category>
		<category><![CDATA[Research]]></category>

		<guid isPermaLink="false">http://penn.museum/blog/?p=4486</guid>
		<description><![CDATA[Note: The internet comes and goes at Kenya in the moment. Mostly goes. As such, this post is a few days late. Pardon our tardiness. We’ll get back on schedule lickety-split. ***** I would say the weather in Nairobi is temperate. Gray clouds floated by today without dropping their contents, except for the short but [...]]]></description>
			<content:encoded><![CDATA[<p>Note: The internet comes and goes at Kenya in the moment. Mostly goes. As such, this post is a few days late. Pardon our tardiness. We’ll get back on schedule lickety-split.</p>
<p>*****</p>
<p>I would say the weather in Nairobi is temperate. Gray clouds floated by today without dropping their contents, except for the short but violent tantrums when they did. It&#8217;s the sort of taunting atmosphere that makes the decision of whether or not to wear a jacket a real existential crisis.</p>
<p>I’ve been told that it’ll be chillier in Laikipia. That should make these things clearer cut.</p>
<p>*****</p>
<p>That&#8217;s how you start conversations, you know, at least in the States. You talk about the weather. It&#8217;s a pretty safe bet that wherever there are people, there is weather nearby.</p>
<p>*****</p>
<p>Now that those formalities are over, let&#8217;s get to some more formalities. My name is Paul Mitchell and I&#8217;m in Kenya in order to put some of the parts of at least one person in a few bags. Of course, there&#8217;s more to the story, but we’ve got to introduce the <em>dramatis personae</em> first. It’s a convention to do so, but perhaps an informative one.</p>
<p>At this point, what you need to know is that I&#8217;m a student at the University of Pennsylvania in Philadelphia, a major in biological anthropology and philosophy, am twenty-one years young and work at the Penn Museum in the skeletal collection. As such, perhaps you can now contextualize why I&#8217;m interested in people parts. Keenly interested.</p>
<p>*****</p>
<p>Dr. Kathleen Ryan has been to this part of the world many times. When we checked into the United Kenya Club in Nairobi, the porters and receptionists and drivers recognized her, shook her hand and asked how she was. A whole bunch of folks did the same thing when we were at the National Museum. She greets them back in a fantastic accent, grown organically in Ireland. She motions to me, “This is my colleague, Paul.” They shake my hand and hang giant smiles to dry for minutes on a line between their ears.</p>
<p>Kathleen is a woman of many hats, but you can call her an archaeologist if you want to affix a single label. Her archaeozoology lab neighbors one of the rooms of the human skeletal collection in the research wing of the Penn Museum. If I recall correctly, I first met her as she popped out of her office, very spryly, as she does, while I was carting skulls through the hallway. I don’t know how it happened, but she asked me to go with her to Kenya some time ago. There are human skeletons to be excavated and examined and samples to be taken for genetic analysis at one of her sites, she explained. My ears perked.</p>
<p>I’m sort of secretly in love with Africa from afar, so I said “yes” at some point. So, that’s why I’m here now with a mosquito net over my bed and a stomach full of coffee that could have been picked only down the road, just as happy as a clam.</p>
<p>*****</p>
<p>My final exams ended on the eighth of May. On the ninth of May, mostly braindead, I was leaving with Kathleen. We got on a plane in Philadelphia, heading to Nairobi by way of a connecting flight in London. I was reading <em>Lolita</em> and bothering the stewardesses all the time for more coffee. A towheaded toddler behind me cried and cried. I sat next to a fellow Penn student. He was a sophomore and from Nairobi himself. He studied finance. I decided that we wouldn’t talk about academics.</p>
<p>*****</p>
<p>We had four hours to kill in Heathrow. Kathleen declared that we needed something to eat. It was breakfast time, vaguely. We stopped at a cafe which had tall, orange plastic giraffes, twice a person’s height, in the middle of the dining area. She ordered something with bacon and eggs and toast and home fries. I ordered something with avocados and cherry tomatoes and hummus and sourdough. I think she chuckled at me.</p>
<p>Kathleen couldn’t weigh more than one hundred pounds when carrying two full bags of groceries in a monsoon.</p>
<p>“As much as one hundred and three pounds,” she marmishly retorted when I was brazen enough to broach the subject. I want to get the facts straight.</p>
<p>*****</p>
<p>We met Louise in London. Louise is a chemist and will be joining us in Laikipia. She’s from New York but just got back from the Caribbean. Erika and Jen and her retinue are supposed to be here later, too. Holy smokes, all the people, dead and alive. The dead people will come into the story later. All the actors in the play so far are alive, alive, alive.</p>
<p>*****</p>
<p>We got to Nairobi without difficulty. As we flew in, I watched the sun set out the window over the southern tendrils of the Sahara. Justus and Kamande met us at the airport and drove us to our accommodations at the United Kenya Club. While Kamande drove and chatted with Kathleen up at the front of the van, Justus told Louise and I all about his thoughts on politics, religion, and the medicinal applications of the local flora.</p>
<p>It was late by the time we got in. We drank these bottled beverages called Tangawizis on the porch. They’re ginger beers and they’ll clear your sinuses. The club is great. It has a big porch where you can drink things. Like soda.</p>
<p>*****</p>
<p>We had to do a whole mess of things on Friday before we leave for Laikipia on Sunday. First, there were permits to be gotten at the National Museum. I saw a statue of Louis Leakey. I got excited.</p>
<p>We journeyed to the archaeology department’s main office. Some other folks who looked as if they had similar prurient archaeological ambitions and needed permits, too, were milling around. They were a cheery lot. Mary is an archaeozoologist like Kathleen. She invited me to help her wash her microfaunal bones sometime. Oh yeah. Susana spends the lion’s share of her time digging up rocks that chimpanzees used to crack nuts hundreds and thousands of years ago. She’s going to Koobi Fora now to look at lithics. Little stone tools. We all must have been strange children.</p>
<p>*****</p>
<p>Dr. Purity Kiura, Head of Archaeology at the Museum and Professor Mulu from the University of Nairobi helped Kathleen get the permits. There were letters to be written and fees to be paid. After scribbling the necessary signatures, we got a tour of the osteology department. See?</p>
<p><a href="http://penn.museum/blog/africa-2/kenya/kenya-2012-bones-bodies-misbehavior/attachment/kathleen_paul_sm/" rel="attachment wp-att-4488"><img class="alignnone size-medium wp-image-4488" src="http://penn.museum/blog/wp-content/uploads/2012/05/kathleen_paul_sm-300x225.jpg" alt="" width="300" height="225" /></a></p>
<p>Paul and Kathleen</p>
<p><a href="http://penn.museum/blog/africa-2/kenya/kenya-2012-bones-bodies-misbehavior/attachment/louise_warthogs_sm/" rel="attachment wp-att-4489"><img class="alignnone size-medium wp-image-4489" src="http://penn.museum/blog/wp-content/uploads/2012/05/louise_warthogs_sm-300x225.jpg" alt="" width="300" height="225" /></a></p>
<p>Louise and the warthogs</p>
<p><a href="http://penn.museum/blog/africa-2/kenya/kenya-2012-bones-bodies-misbehavior/attachment/osteology_sm/" rel="attachment wp-att-4492"><img class="alignnone size-medium wp-image-4492" src="http://penn.museum/blog/wp-content/uploads/2012/05/osteology_sm-300x225.jpg" alt="" width="300" height="225" /></a></p>
<p>Osteology crew at the NMKN</p>
<p><a href="http://penn.museum/blog/africa-2/kenya/kenya-2012-bones-bodies-misbehavior/attachment/paul_gorilla_mod_sm/" rel="attachment wp-att-4490"><img class="alignnone size-medium wp-image-4490" src="http://penn.museum/blog/wp-content/uploads/2012/05/paul_gorilla_mod_sm-249x300.jpg" alt="" width="249" height="300" /></a></p>
<p>Paul loves gorillas.</p>
<p><a href="http://penn.museum/blog/africa-2/kenya/kenya-2012-bones-bodies-misbehavior/attachment/corruption_sm/" rel="attachment wp-att-4487"><img class="alignnone size-medium wp-image-4487" src="http://penn.museum/blog/wp-content/uploads/2012/05/corruption_sm-300x225.jpg" alt="" width="300" height="225" /></a></p>
<p>Here’s my favorite box at the museum. I think it wouldn’t be a terrible idea to install some of these in D.C.</p>
<p><a href="http://penn.museum/blog/africa-2/kenya/kenya-2012-bones-bodies-misbehavior/attachment/coconut_sm/" rel="attachment wp-att-4491"><img class="alignnone size-medium wp-image-4491" src="http://penn.museum/blog/wp-content/uploads/2012/05/coconut_sm-300x225.jpg" alt="" width="300" height="225" /></a></p>
<p>We ate at the museum. Louise ordered tilapia. Mary joined us for lunch and looked at the tilapia bones after Louise was done.</p>
<p>*****</p>
<p>It took us all afternoon to get what we needed at the mall. The ATM wasn’t working and the air conditioning was out. It was significantly hotter inside than outside under the mercurial Nairobi sky. Laikipia is a six hour drive away, so we needed to ensure that we have water and food and all that jazz for the journey there. I got a bunch of instant coffee and chewing gum. Priorities, you see. It was something of a hectic experience buzzing around a Kenyan mall, looking for this and looking for that. People pour over everywhere and it isn’t always intuitive where they’ve stashed what you’re looking for. Kathleen bought some sunglasses, which I think are very stylish. The height of fashion, my little droogies.</p>
<p>*****</p>
<p>Soon, we’ll be out of Nairobi. The skeletons we’re supposed to sample in a place called Mpala on the Laikipia Plateau are west of here, between Mt. Kenya to the south and Lake Turkana to the north. We’ve been here since Thursday evening. One more day at the museum before Erika arrives, we can get out of here, and the work can begin in earnest.</p>
<p>Kathleen showed me a photo of one of the burials at Laikipia. Brittle bones in the earth. They dug up one of the many burial cairns in Mpala a year ago. The skeleton isn’t in anatomical position. At risk of sounding irreverent, it looks like someone sprinkled those bones on the grave like potpourri on a the centerpiece of a dining table in a kitschy interior decorating magazine. Normally, you can expect bones to fit together in a pretty predictable way. There is no natural articulation in which you’ve got an ectocuneiform articulating with an ethmoid. Know what I mean?</p>
<p>***** WARNING: Technical Details *****</p>
<p>At this point, let’s get into some of the nitty-gritty, but truly delicious, details of the science of what the heck I’m doing out here in Kenya:</p>
<p>There are certain parts of the skeleton that I want to put in our very official sterile containers and send to the lab. Some parts are better than others. Buried like storied treasure in the collagen of bone and in the pulp of teeth is the thing we seek: acid. Deoxyribonucleic acid, that is. DNA. We hope to grind up these bones into little pieces and look at these people’s genes. That’s the big idea. Big ideas are composed of little ideas, all sorts of devilish details. Let’s unpack them.</p>
<p>I figure there are two ways to talk about this project. We can ask “why?” and we can ask “how?” For the moment, even though it’s a little pedantic, let’s take the “how?” stance.</p>
<p>In the barest bones sort of way, here’s what we’re talking about: getting DNA from dead people in the ground.</p>
<p>The big issue is making sure that we don’t have any contamination in the bones that we’re digging up. Of course, I’m dropping my own DNA at record pace with little strands of hair, globules of mucus, and the constant shedding of dead skin cells which I very liberally drop everywhere so as to create a genetic trail of the places I’ve been. You do it, too, so don’t look at me like I’m weird.</p>
<p>The best way to avoid contamination of our sample is to not touch the bones from the site without sterile gloves and to not cut them in the field, and have as few folks as possible getting up close and personal with the skeleton. That’s my job, you see. Getting up close and personal with the skeleton. Communing with the dead. If there’s only one person likely to contaminate the skeleton and you take his or her DNA, then you only have to test for contamination by one person.</p>
<p>Of course, it’s not just human DNA that can contaminate this thing. All over the place, little bacteria swarm about in hordes the immense number of which human minds don’t have the capacity to entertain. Those suckers get into the bone and leave their DNA, contaminating our samples with the genes of those fantastically complex microscopic slimeballs. Human genes, the genes of the person to whom the skeleton used to belong, are what we’re after, however. We’re trying to avoid sequencing bacteria genes.</p>
<p>Our best bet is to get bits of the skeleton that have a lot of cortical bone, which is the hard part of the structure and essentially the part that we can see from the outside. The deepest part of the inside of bones is hollow but has trabecular, also known as spongey, bone, but there’s not much hope of getting any DNA from that stuff. Cortical bone is dense, with a lot of collagen around the osteocytes, the bone cells. Since it’s so dense, it’s harder for bacterial or human or whatever contamination to get into it. That’s the key.</p>
<p>Some bones need to be cut if we want to fit them into the containers we have, which can introduce all sorts of nasty contamination into the sample. No, no. We’re looking for the most cortical bone for our buck on the smallest bones that we don’t need to cut. What do we want? First ribs, clavicles (collarbones), metatarsals (the rays of the foot), metacarpals (the rays of the hand), phalanges (fingers and toes), and maybe some tarsal (foot, ankle) and carpal (hand, wrist) bones are what we’re looking to snag.</p>
<p>Of course, there’s no guarantee that the collagen didn’t get washed away in the water in the soil or destroyed due to temperature or any number of other things. What we’ll have to do before we can even think about looking at the genes is testing to make sure the collagen is there. It’s in the nucleus of the collagen cells that the genes do dwell. What we’ll do is have the lab folks test these guys for nitrogen content. There’s nitrogen in collagen, which is a protein, but not so much in the mineral structure of the bone made from calcium, which contains no DNA. If there’s a good deal of nitrogen there, it means that we’ve got some collagen. So, having collagen is a necessary condition for getting at the genes. But, as you’ll see, it is not sufficient.</p>
<p>The skeletons we’re looking at haven’t been properly dated, so we don’t know how long those little strands of genetic material have been sitting there ever so compactly in the nuclei of those cells. During life, if something goes wonky with the DNA, there are little machines in your cells called polymerases which fix the problem. Those machines stop working when you’re dead, but plenty of things can still go wrong. Among other things, heat makes the DNA fall apart, and the little particles of background radiation that generally pass through our bodies little BBs through latticework occasionally knock a nucleotide or two. This changes the structure of the DNA and messes up our ability to put things back together like they were when the person actually had these genes working in their body. Things fall apart. We futilely fight entropy, folks. We can have a bunch of bones stocked to the brim with collagen, nice and uncontaminated, but the DNA will be just too degraded to use. Let’s all cross our fingers that such isn’t the case. Kathleen has had some folks scout these sites and it looks like the ground in which these skeletons are buried is very favorable to DNA preservation and they’ll be recent enough that we won’t have too many issues. Fingers crossed, eh?</p>
<p>We have to keep the skeletons clean, we have to hope we’ve got collagen, and we’ve got to hope our DNA is nicely preserved. A lot to ask of the universe, but we may have luck yet.</p>
<p>Since the skeleton that was previously excavated is not in anatomical position, as I mentioned way above, that means that the graves we’ll be looking at were likely disturbed by animals long ago. I’ll have to search for the bones I want as I dig. I can’t expect to follow the radius to the carpals and metacarpals that I want, you see. The complexity of things never, ever ceases to amaze me. There’s delicate work to be done.</p>
<p>And, before I forget, we’ll take some teeth. You can do different things with teeth and bone. They’re made of different stuff. The mineral structure of bone grows and remodels, changing through life. The enamel on teeth doesn’t. Ever break a bone? It heals. Ever chip a tooth? Tough luck. Since enamel only grows once, it contains a chemical record of the first decade or so of life, since, in sort of simplified terms, the body uses the chemicals it has to make the teeth. There is no DNA in enamel, but there is DNA aplenty in the pulp in the middle of teeth. The pulp is the part that contains the nerves that hurt real bad when you have a tooth infection or get a root canal. I think I’ll carefully collect some molars to get at their DNA. That should do the trick.</p>
<p>***** END of Technical Details *****</p>
<p>I’ve been writing this thing for a while. It’s early in the morning and I’m hungry. I think I’ll go to the dining hall and get breakfast. They make pretty good semolina porridge here and the papaya is out of this world.</p>
<p>* <a href="http://www.jstor.org/discover/10.2307/3173778?uid=3738336&amp;uid=2129&amp;uid=2&amp;uid=70&amp;uid=4&amp;sid=21100802361451" title="Here" target="_blank">Title inspiration.</a></p>
]]></content:encoded>
			<wfw:commentRss>http://penn.museum/blog/africa-2/kenya/kenya-2012-bones-bodies-misbehavior/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>Ban Chiang Pots: Under the Macro Lens</title>
		<link>http://penn.museum/blog/museum/ban-chiang-pots-under-the-macro-lens/</link>
		<comments>http://penn.museum/blog/museum/ban-chiang-pots-under-the-macro-lens/#comments</comments>
		<pubDate>Mon, 07 May 2012 19:58:54 +0000</pubDate>
		<dc:creator>kelsey</dc:creator>
				<category><![CDATA[Museum]]></category>

		<guid isPermaLink="false">http://penn.museum/blog/?p=4455</guid>
		<description><![CDATA[Archaeological research relies on sharp close-up photographs to document and illustrate observations on artifacts. I was very fortunate to have been hired by the Ban Chiang Project, for my work study position this past year, and be able to use my professional skills in photography for the fascinating assignment of making detailed photographs of their [...]]]></description>
			<content:encoded><![CDATA[<p>Archaeological research relies on sharp close-up photographs to document and illustrate observations on artifacts. I was very fortunate to have been hired by the <a title=" Ban Chiang Project " href="http://penn.museum/banchiang" target="_blank">Ban Chiang Project</a>, for my work study position this past year, and be able to use my professional skills in photography for the fascinating assignment of making detailed photographs of their ceramics. The pottery collection Penn archaeologists excavated in Thailand during the 1970s is slated for publication in an upcoming monograph, and the volume needs this careful visual documentation.</p>
<p>Photographs that show how the pots were made are a top priority, and I had to develop my skills in macro-photography with shallow-depth-of-field and high contrast lighting to bring out the important details.</p>
<p style="text-align: left"><img src="http://farm9.staticflickr.com/8152/7128442361_1194af89a4.jpg" alt="Image 1 and 2" /></p>
<p><em>Above: Photographs of fresh breaks in the ceramics show evidence of firing practices and clay preparation. We can see some of the coarser inclusions added to the clay by the potters.</em></p>
<p>For me the most interesting thing about photographing the ceramics collection is the diversity of skill by the potters. The pots that are not completely finished, smoothed, or made by skilled craftsmen tend to be the most fun to photograph because they really tell a story. Instead of covering up the history of the pot, the little flaws remain a sculptural record of how the pots were made. Every imperfection is not just a visual hiccup but instead a possible lead to unravel techniques and technologies used in fabrication. Many times, I find that my favorite pots to photograph are the least &#8220;photogenic&#8221; on the whole. However, up-close with the macro lens these pots reveal a totally different world.</p>
<p style="text-align: left"><img src="http://farm8.staticflickr.com/7179/7128442469_06f8cea4f7_b.jpg" alt="Image 3 and 4" /></p>
<p><em>Above: We look at not only the shape of the pot but also the quality of the painted and incised decoration. Was the pot on the left decorated by an apprentice? Sometimes poorly skilled decoration is put on well-formed pots, showing that perhaps multiple people worked on each pot as part of the learning process. In contrast, other pots like the one on the right show a high level of meticulous craftsmanship in their decoration.</em></p>
<p>Photographing these subtle details with the macro lens is surprisingly difficult. Sometimes the features are very obvious because they have not been smudged, smoothed, or covered up. However, the majority of the time the details are very subtle, and <a title="Dr. Marie-Claude Boileau " href="http://penn.museum/banchiang/about/staff/marie-claude-boileau/" target="_blank">Dr. Marie-Claude Boileau</a> and I have to search to find them. Once we have identified the features that need to be photographed, I work changing the light very dramatically as I photograph them. With the use of both studio lights and a ring-flash, I can bring these details out and put them on display for the camera in a way that they are not visible to the human eye in regular light.</p>
<p style="text-align: left"><img src="http://farm8.staticflickr.com/7061/6967468048_eff805b5f9.jpg" alt="Image 5" /></p>
<p><em>Above: The vertical shaving technique used on the foot of this pot is made more visible by using strong raking light from the left side</em></p>
<p style="text-align: left"><img src="http://farm8.staticflickr.com/7129/7113544457_6e871fd39d.jpg" alt="Image 6" /></p>
<p><em>Above: Photographing vessel interiors can be a real trick. On the interior of this pot, a horizontal coil join and oblique scraping marks can be seen in raking light.</em></p>
<p>For each pot and each photo, I change the light and position of the pot to maximize the visual drama of these features so that the photographs can really tell the story of how the pot was made. However, sometimes small details are overlooked so easily that it is only mid-photo shoot that I suddenly discover their presence when light hits the pot a certain way. It’s truly an optical illusion: now you see it, now you don’t. The photograph is important because it keeps a permanent record of this visual research.</p>
<p style="text-align: left"><img src="http://farm8.staticflickr.com/7049/7113544539_302d90e535.jpg" alt="Image 7" /></p>
<p><em>Above: Anvil impressions on the interior surface of this pot show how the pot was beaten with a paddle and anvil. These are details that are hard to see without lighting the interior of the pot properly.</em></p>
<p>About the author: <a title="Kelsey Halliday Johnson" href="http://kelseyhalliday.com/" target="_blank">Kelsey Halliday Johnson</a>, is the Ceramics Collection Manager for the Ban Chiang Project. She is graduating with an interdisciplinary M. F. A. (Masters of Fine Arts) from Penn Design pursuing a certificate in Landscape Studies; and an instructor in the Undergraduate Fine Arts Department, teaching Introduction to Photography. Kelsey received her B. A. from Princeton University in Art and Archaeology with a certificate in European Cultural Studies. She has specialized experience managing large, typically visual, databases and would like to continue teaching and working in museums in the future.</p>
<p>　</p>
]]></content:encoded>
			<wfw:commentRss>http://penn.museum/blog/museum/ban-chiang-pots-under-the-macro-lens/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>Ur Digitization Project: Item of the Month</title>
		<link>http://penn.museum/blog/iraq/ur-digitization-project-item-of-the-month/</link>
		<comments>http://penn.museum/blog/iraq/ur-digitization-project-item-of-the-month/#comments</comments>
		<pubDate>Mon, 07 May 2012 14:09:41 +0000</pubDate>
		<dc:creator>William Hafford</dc:creator>
				<category><![CDATA[Iraq]]></category>

		<guid isPermaLink="false">http://penn.museum/blog/?p=4424</guid>
		<description><![CDATA[Excavations at Ur, the ancient city said to be the birthplace of Abraham, were conducted jointly by the Penn Museum and the British Museum from 1922-1934. The artifacts were divided under laws of the time, with half remaining in the new country of Iraq and the other half split between the excavating institutions. Sir Leonard [...]]]></description>
			<content:encoded><![CDATA[<p>Excavations at Ur, the ancient city said to be the birthplace of Abraham, were conducted jointly by the Penn Museum and the British Museum from 1922-1934. The artifacts were divided under laws of the time, with half remaining in the new country of Iraq and the other half split between the excavating institutions. Sir Leonard Woolley excavated on behalf of the two museums and his notes, photos and reports from the field were also divided. Furthermore, many other documents and photos are scattered across the globe in private archives, public newspapers, journals and monographs. Many fascinating people visited and/or worked at Ur, including the famous mystery writer Agatha Christie, whose time at the site served as background material for her book <em>Murder in Mesopotamia</em>. The Ur Digitization Project is reuniting Ur in a virtual space.</p>
<p>In my capacity as manager for the project, I come across a plethora of interesting things. It’s hard to decide on a few favorites to highlight, but I’ll be doing just that over the next few months. I’ll also be highlighting the issues such items bring up for research and for digitization. Let’s start off with an artifact from the very first season of digging. You’ll notice that the ‘U-number’ (assigned in the field by Woolley) is very low at U.72. To put it in perspective, the last number Woolley assigned was U.20094.</p>
<p>Artifact of the month</p>
<p>Spotlight on Field Number U.72 (Museum Number B15192)</p>
<p>Miniature clay mask</p>
<div id="attachment_4443" class="wp-caption aligncenter" style="width: 285px"><a href="http://penn.museum/blog/iraq/ur-digitization-project-item-of-the-month/attachment/uphoto0038/" rel="attachment wp-att-4443" target="_blank"><img class="size-medium wp-image-4443" src="http://penn.museum/blog/wp-content/uploads/2012/05/Uphoto0038-275x300.jpg" alt="" width="275" height="300" /></a><p class="wp-caption-text">Portion of field photo no. 38 showing object no. U.72. Click on link below to go to current Penn Museum record for this object.</p></div>
<p><a href="http://www.penn.museum/collections/search.php?object_name=&amp;object_number=u.72&amp;date_of_object=&amp;provenience_culture=&amp;culture=&amp;credit_line=&amp;material=&amp;submit_multi=Submit+Query" target="_blank">This object, only 6.5 cm (2.6 inches) long, is an expressive, grimacing face molded from clay</a>. Woolley often described such masks as ‘grotesque,’ though he used the term in an art historical sense as descriptive rather than judgmental. Indeed, these small masks were almost certainly <em>apotropaic</em>&#8211;representative of rather horrifying beings used as amulets to ward off evil. Such objects are common throughout the ancient world, including representations of the medusa in Classical Greece. Athena’s shield is often displayed as bearing an image of this menacing creature whose gaze was said to turn onlookers to stone.</p>
<p>In the ancient Near East there was no legend of Medusa, but there were plenty of demonic figures; and who better to scare away evil? One of the scariest was Puzuzu, an Assyrian demon who is often represented at gateways to keep bad things out of a building. Woolley had an even more specific explanation, one he wrote up in the <em>London Times</em> in July 1925 when reporting on an early exhibit of Ur artifacts in  the British Museum:<br />
&#8220;One quaint little mask is described as the head of the god Pazuzu, and is also a charm to be suspended in the window to keep away the sickness brought by the south-east wind.&#8221;</p>
<p>But Puzuzu appears rather late in time as far as Ur is concerned, with most confirmed representations being Iron Age. A good deal of the Ur material is Bronze Age, so who is the demon represented here? Most scholars believe it is Humbaba, the giant whom Gilgamesh in legend defeated at the Cedar Forest. Humbaba was certainly a formidable foe, said to be “a terror to humans” and to have the “visage of death.” Some suggest that the representation of his facial features was inspired by human intestines, and perhaps that is shown in the cheeks and chin of our mask, though it may equally be an attempt at facial hair.</p>
<p>When the mask was found, it was recorded in field records. Those records are currently unpublished, but are particularly important to our project. Here is the entry for U.72:</p>
<div id="attachment_4426" class="wp-caption aligncenter" style="width: 271px"><a href="http://penn.museum/blog/iraq/ur-digitization-project-item-of-the-month/attachment/u072/" rel="attachment wp-att-4426"><img class="size-medium wp-image-4426" src="http://penn.museum/blog/wp-content/uploads/2012/04/U072-261x300.jpg" alt="U.72 catalogue card" width="261" height="300" /></a><p class="wp-caption-text">Field catalogue entry for U.72. The notes are in Woolley’s hand and the drawing is probably his as well.</p></div>
<p>Note that the entry includes the find spot, though not in great detail. It mentions the “other side of the railway line about ¾ miles N. of Ur Junction.” This was an area later called ‘the railway site’ and is the edge of the suburb of Ur called Diqdiqqeh. Over the years, this area produced many clay figurines, plaques and amulets and was almost certainly a manufacturing area as well as a trading center.</p>
<p>By combining all the information available on any object, the picture becomes much clearer; not just the picture of that artifact, but of its usage and of life at the city in general. Even more important will be the further combining and comparison of data from this site with other sites across the Near East for a more complete understanding of history itself.</p>
<p>&nbsp;</p>
]]></content:encoded>
			<wfw:commentRss>http://penn.museum/blog/iraq/ur-digitization-project-item-of-the-month/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>MAYA 2012: Tunnels</title>
		<link>http://penn.museum/blog/museum/maya-2012-tunnels/</link>
		<comments>http://penn.museum/blog/museum/maya-2012-tunnels/#comments</comments>
		<pubDate>Fri, 20 Apr 2012 19:53:15 +0000</pubDate>
		<dc:creator>Gabrielle Niu</dc:creator>
				<category><![CDATA[Museum]]></category>

		<guid isPermaLink="false">http://penn.museum/blog/?p=4412</guid>
		<description><![CDATA[Loa Traxler, curator of MAYA 2012: Lords of Time, explains how archaeologists used tunnels to excavate at the ancient site of Copan in Honduras. Get a look into the excavation tunnels in the video below:]]></description>
			<content:encoded><![CDATA[<p><a href="http://www.penn.museum/sites/2012/about/contributors/">Loa Traxler</a>, curator of <a href="http://www.penn.museum/sites/2012/">MAYA 2012: Lords of Time</a>, explains how archaeologists used tunnels to excavate at the ancient site of Copan in Honduras. Get a look into the excavation tunnels in the video below:</p>
<p><object width="600" height="335"><param name="movie" value="https://www.youtube-nocookie.com/v/TSiNCmsaeLQ?version=3&amp;hl=en_US"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="https://www.youtube-nocookie.com/v/TSiNCmsaeLQ?version=3&amp;hl=en_US" type="application/x-shockwave-flash" width="600" height="335" allowscriptaccess="always" allowfullscreen="true"></embed></object> </p>
]]></content:encoded>
			<wfw:commentRss>http://penn.museum/blog/museum/maya-2012-tunnels/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>MAYA 2012: The Ancient Maya and Human Sacrifice</title>
		<link>http://penn.museum/blog/museum/maya-2012-ancient-maya-human-sacrifice/</link>
		<comments>http://penn.museum/blog/museum/maya-2012-ancient-maya-human-sacrifice/#comments</comments>
		<pubDate>Thu, 05 Apr 2012 18:35:59 +0000</pubDate>
		<dc:creator>Gabrielle Niu</dc:creator>
				<category><![CDATA[Maya]]></category>
		<category><![CDATA[Museum]]></category>
		<category><![CDATA[2012]]></category>
		<category><![CDATA[lords of time]]></category>
		<category><![CDATA[maya]]></category>
		<category><![CDATA[ritual]]></category>
		<category><![CDATA[sacrifice]]></category>

		<guid isPermaLink="false">http://penn.museum/blog/?p=4391</guid>
		<description><![CDATA[In the movie Apocalypto, Mel Gibson offers a very Hollywood portrayal of the human sacrifice rituals at end of the Maya Classical Period. While human sacrifice played a role in the ritual practices of the ancient Maya, it was not exactly as Gibson and Hollywood conceived of it. Loa Traxler, curator of MAYA 2012: Lords [...]]]></description>
			<content:encoded><![CDATA[<p>In the movie <em>Apocalypto</em>, Mel Gibson offers a <a title="Link to Apocalypto Scene" href="http://www.youtube.com/watch?v=O_99mcINufQ"> very Hollywood portrayal</a> of the human sacrifice rituals at end of the Maya Classical Period.</p>
<p>While human sacrifice played a role in the ritual practices of the ancient Maya, it was not exactly as Gibson and Hollywood conceived of it. <a href="http://www.penn.museum/sites/2012/about/contributors/">Loa Traxler</a>, curator of <a href="http://www.penn.museum/sites/2012/">MAYA 2012: Lords of Time</a>, explains how this sort of ritual functioned in the lives of the ancient Maya.</p>
<p><object width="600" height="335"><param name="movie" value="https://www.youtube-nocookie.com/v/bGWZY8Q8bA8?version=3&amp;hl=en_US"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="https://www.youtube-nocookie.com/v/bGWZY8Q8bA8?version=3&amp;hl=en_US" type="application/x-shockwave-flash" width="600" height="335" allowscriptaccess="always" allowfullscreen="true"></embed></object></p>
]]></content:encoded>
			<wfw:commentRss>http://penn.museum/blog/museum/maya-2012-ancient-maya-human-sacrifice/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>Why are Zach and Courtney Hot Glueing Worry Dolls?</title>
		<link>http://penn.museum/blog/exhibits/why-are-zach-and-courtney-hot-glueing-worry-dolls/</link>
		<comments>http://penn.museum/blog/exhibits/why-are-zach-and-courtney-hot-glueing-worry-dolls/#comments</comments>
		<pubDate>Fri, 30 Mar 2012 19:27:57 +0000</pubDate>
		<dc:creator>Amy Ellsworth</dc:creator>
				<category><![CDATA[Exhibits]]></category>
		<category><![CDATA[Maya]]></category>
		<category><![CDATA[guatemala]]></category>
		<category><![CDATA[Maya 2012]]></category>
		<category><![CDATA[worry dolls]]></category>

		<guid isPermaLink="false">http://penn.museum/blog/?p=4373</guid>
		<description><![CDATA[I walked into the Exhibits office today and saw bags and bags of what looked like little firecrackers. They always seems to have odd bulk shipments back there (fake hair, desiccated fruits, papier-mâché mummy parts), so I didn&#8217;t even question what they were doing with them. Upon closer inspection, I realized they were worry dolls, [...]]]></description>
			<content:encoded><![CDATA[<p>I walked into the Exhibits office today and saw bags and bags of what looked like little firecrackers. They always seems to have odd bulk shipments back there (fake hair, desiccated fruits, papier-mâché mummy parts), so I didn&#8217;t even question what they were doing with them.</p>
<p>Upon closer inspection, I realized they were worry dolls, and Courtney and Zach were shooting them with glue guns. They said it was for the exit experience of the <a title="MAYA 2012" href="http://penn.museum/2012" target="_blank">MAYA 2012 exhibit.</a></p>
<p>To find out what exactly is going to happen in this exit experience, you will just have to <a title="MAYA 2012" href="http://penn.museum/2012" target="_blank">go through the entrance first!</a> (Actually, in museology terms, it&#8217;s called the &#8220;threshold experience.&#8221;)</p>
<p><img src="http://farm8.staticflickr.com/7233/6883858980_b151a1983b_z.jpg" alt="" width="600" /></p>
<p><img src="http://farm7.staticflickr.com/6095/6883859904_f4e56bdd43_z.jpg" alt="" width="600" /></p>
<p><img src="http://farm8.staticflickr.com/7243/7029959453_900356a966_z.jpg" alt="" width="600" /></p>
<p><strong>What are worry dolls?</strong></p>
<blockquote><p>Doubts, fears, and worries about the future are a natural part of life. Worry dolls are part of the folklore of Guatemala that are used to deal with these concerns. According to tradition, the dolls take away your anxiety when you tell them your worries and sleep with them under your pillow.</p></blockquote>
]]></content:encoded>
			<wfw:commentRss>http://penn.museum/blog/exhibits/why-are-zach-and-courtney-hot-glueing-worry-dolls/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
	</channel>
</rss>

